Python Functions:gcufbioinfo

Functions perform an operation on one or more values and return a result. Python comes with many pre-defined functions, as well as the ability to define your own functions. Let's look at a couple of the built-in functions: len() returns the number of items in a sequence; dir() returns a list of strings representing the attributes of an object; list() returns a new list initialized from some other sequence.

>>> dna = 'CTGACCACTTTACGAGGTTAGC' 
>>> bases = ['A', 'C', 'G', 'T'] 
>>> len(dna) 
22 
>>> len(bases) 
4 
>>> dir(dna) 
['__add__', '__class__', '__contains__', '__delattr__',  
'__doc__', '__eq__', '__ge__', '__getattribute__', '__getitem__',  
'__getslice__', '__gt__', '__hash__', '__init__', '__le__',  
'__len__', '__lt__', '__mul__', '__ne__', '__new__', '__reduce__',  
'__repr__', '__rmul__', '__setattr__', '__str__', 'capitalize',  
'center', 'count', 'decode', 'encode', 'endswith', 'expandtabs',  
'find', 'index', 'isalnum', 'isalpha', 'isdigit', 'islower',  
'isspace', 'istitle', 'isupper', 'join', 'ljust', 'lower',  
'lstrip', 'replace', 'rfind', 'rindex', 'rjust', 'rstrip', 'split',  
'splitlines', 'startswith', 'strip', 'swapcase', 'title',  
'translate', 'upper'] 
>>> dir(bases) 
['__add__', '__class__', '__contains__', '__delattr__',  
'__delitem__', '__delslice__', '__doc__', '__eq__', '__ge__',  
'__getattribute__', '__getitem__', '__getslice__', '__gt__',  
'__hash__', '__iadd__', '__imul__', '__init__', '__le__', '__len__',  
'__lt__', '__mul__', '__ne__', '__new__', '__reduce__', '__repr__',  
'__rmul__', '__setattr__', '__setitem__', '__setslice__', '__str__',  
'append', 'count', 'extend', 'index', 'insert', 'pop', 'remove',  
'reverse', 'sort'] 
>>> list(dna) 
['C', 'T', 'G', 'A', 'C', 'C', 'A', 'C', 'T', 'T', 'T',  
'A', 'C', 'G', 'A', 'G', 'G', 'T', 'T', 'A', 'G', 'C']